this post was submitted on 23 Jul 2023
421 points (94.3% liked)

Memes

51640 readers
1574 users here now

Rules:

  1. Be civil and nice.
  2. Try not to excessively repost, as a rule of thumb, wait at least 2 months to do it if you have to.

founded 6 years ago
MODERATORS
 

An image of Mr Krabs saying "Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG"

you are viewing a single comment's thread
view the rest of the comments
[–] Mininux@sh.itjust.works 10 points 2 years ago (3 children)

If we ignore the mutations in the life of an individual, it would actually only be a few hundreds megabytes. Or if we already have a template of a human genome and we only code the difference between them and the human we want to copy, a few megabytes is enough since we all share A LOT of sequences

Wikipedia: Human genome#Information content

[–] Kowowow@lemmy.ca 4 points 2 years ago

ya I've kind of been wondering if with how foods and random mutations affect dna I doubt you could use baby you dna to get an adult that actually looks exactly like you

[–] capy_bara@lemmy.world 2 points 2 years ago (1 children)

There is also epigenetic modifications to be considered

[–] Mininux@sh.itjust.works 1 points 2 years ago

Oh cool I didn't know that stuff, it's super interesting

[–] 30isthenew29@lemm.ee 0 points 2 years ago

It bottles the mind.